EST 1200094 is a singleton


Sequence

>1200094 (1 EST) Length=217 TATATTAACTATTTATAATAAATGTGCGTGATGAGGAAGAAGAATAATTGATTCGTGTCTTTTTATATTTATTGTACATA AAAAATAAAACATTTATATTTTTACACATATATCATTTAAATGTAACATTATTGACTTGTTATATTTCATAAGAGAATTT TTATTTAAAAAAAAAAAGAAAAAGTNNAAGGATAAAAGAAAGGATAAAAAAAAGGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200094: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000942320336AA5500841182m3gmbPfHB3.1, G. Roman Reddy


Date: 14:59:34 on Sun 19 Nov 117.