EST 1200095 is a singleton


Sequence

>1200095 (1 EST) Length=482 TACATATAATATTATCCTTACTTACATTATTATTACTACTATTAATATTATCTTTCTTAACACTTTCATACTTTTCCTTT TTCTTATAATCTACAAGAAGTAAATGTTTTATATCTGGATGATCAATAATGTTGAAAATTTTTTCTTCAAAATAAAAATA TTCATATATGCATTTATTCACCTGGGCTCTTTCATGATTAGTAAAGAAAAACCTCTTCTTTATATTCACCACGAAATTAA GAAGAAATCTTTTCCCTTTCATTTTATAAAAAAGAACAAACAAAAAAAAAAAAAAAAATTATTTACATTTTTATATATAT TATCAACTTAATATATATATATATATATTATCATTTTATTAATTATATATAGTACACATTTCACAGATGGGCGTGGGGAT AAAAAAATAAATAAATTATAGGATCGAATTATCTCCTATGGGTGGATCTAGAAAATGGAAATAATATATTCACAAAAAAA TA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200095: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000952320337AA5500851183m3gmbPfHB3.1, G. Roman Reddy


Date: 5:51:40 on Sun 19 Nov 117.