EST 1200101 is a singleton


Sequence

>1200101 (1 EST) Length=499 TTGTGTCTATATACATCTTTGAATTTAAAATTTTTGAGATCTTAATTTGATGGATGGTAAAGGCCCATCTGATTCAGGCC ACGAAACAGTTATACCATTTTGAAAAAGTATAGGTTTATATTGTGGTATTGGTATGGTCATAATCGCTGAATTTCTATAA TGCTCAATATTTGCCTTTAATCCTTGTACTCTTCCCCAAGTAACAGAACAGACTTTGTTACTTTTAAATGCATTGAGTTT ATAATTATTAAAAAATTTGATAAACAATTCAGCATAATATGGATGTATGAAATTAATAAAACCATATCCAACATTACCTT TATTTCTAAAATCAATTGGTAAATAAAAAAAATCATATAAACCTTTAAAATGTTCATTCATAACATCCATCAACATATTT TGTGTATATCTGTTTGGAATATTTCTAAGCATAACTGTTGTAAGAATCTCACTCTTATTATTAATATTCTTATTACAATT GTTCCATATTCTTTCTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200101: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001012320343AA5500911189m3gmbPfHB3.1, G. Roman Reddy


Date: 14:3:35 on Mon 20 Nov 117.