EST 1200110 is a singleton


Sequence

>1200110 (1 EST) Length=512 CTTTTTTTATTTTAAAATCACAATGCAATTATAAGATTCGCTCCTTTTACCAATAAGGTGAAATGTTTCACTATAATTTA TATGTTTATAATTATTTATTTATTTGTTTGTTATTATTTTATTTTTTCATTTTATTTTTTTTTTTATTCTTTATATAAAT TCTTCAATATTTGTTATCCATTCTTATAAATTAAAATACATATGTCACATATATTTTTTTAGATAAAAATATATTCCCCA CATTCTTTAAATATACCTATACATTAATTCGTTATAAACATAAATATGTATATATATATATATGTATGTATATATGTATA TGCATTTTTATACGTACATATTTCTTTTCGTTAATATATCAAAATAAAAACATTAACAATATATATTAACATTTCTCCCA ATGTAACATAAAAAAAAAAAAATATGTATATATATATATATATATATATATATCAGTGAATATACAATTTAGTATACCAT TTTTTTATAAAATATTAAAAATTTCACGTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1200110: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001102320352AA5501001199m3gmbPfHB3.1, G. Roman Reddy


Date: 17:8:13 on Thu 23 Nov 117.