EST 1200116 is a singleton


Sequence

>1200116 (1 EST) Length=489 TATTTTATTTTTTTTTCTGTTTTGTTCTGTTTTGGTCTATTTTTTTCTGTTCTGAATTTTTTTTTTTTTTTTTTTTTTTT TTTTTTGAAATATATGTATAGATATATATATATATATTAATATATTTACCATGACAGAAAGTAATATTATTAATGATGAG AATACTAAAGACAGAGCCTTAGTTTCTACTTTTTGTAACAAAGATGGTTTACGTATAAAAAGTTATTCATGGATAGTGAA AAAAGCTTTAGGTATCATAATATTAATACATGGGTTAGCTCCTCATTTAAGGTTTGGATTTTTAAACAAAAATGCAAAGA TTGTAAGTAATGAGCATGCTGTTTTAATTGATGGAGATAATTATTTTTTATATGAAGGTAGTTGGATTGAGAAATTGAAC AAAAGTGGTTATTCTGTATATGGTTTGGATTTACAAGGTCATGGAGAATCTGATGGATATCAGAATTTAAAATTACATAT TAAAGATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200116: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001162320358AA5501061205m3gmbPfHB3.1, G. Roman Reddy


Date: 23:47:46 on Fri 17 Nov 117.