EST 1200118 is a singleton


Sequence

>1200118 (1 EST) Length=459 CAACTGCAATCAGCCTTTAAAAAACATATAAAACCTAGTGCTAGGAGAACCAATTTATATGAATCCTTAAAAGAATATTA TGAAAAATATATAATAGGAAATAAAAATATAAAAAAATCAAAAAATATTATCATTATTGTAAAAAAATTTACATCAGATG ATTTATCTGAATATCATGAAAATTTAAATAGGTATATTAAAGAAATTAGAAGTAAAGATGTTGGTATATATTTTTTTTCT GATGATAGTATCTATTCTAAAAACATAATACTTAATATTTCAGAAAGTGGATATAATATGGAGGTACAGTATCCCATAGC TCACTTTGTAAGTGAATCATATCGTGCTAATGATCTTTTTGGTGTTAAAAAATTCTGTTATCAATTATTACATGGTGCAA CTTGTAAGAGTTATAATGAGTGGTCAGAATGGTCAGGTCCATGTGAATTTGAAAGAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200118: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001182320360AA5501081207m3gmbPfHB3.1, G. Roman Reddy


Date: 9:31:57 on Sun 19 Nov 117.