EST 1200123 is a singleton


Sequence

>1200123 (1 EST) Length=596 TATATATATATATATATTTATTTATTTTATTTTATTTTATTTTTTTTCTAACCACATCATCATTTCTTCTGTGAGAAAAA TAGGTACCTTGTATTTTTTTAAAGAGTAGATAGACTGTTTGTAAGAAAGAGGTTCCTGAAAATAAATCTTTGTTCATTTT ATAAATAACAAAAAAATCATTTACCACTTCTTTTAACATGGCTTTATTTAAGGTATATGCATATATAAGTCCATGTTTGT AAAAGTTGATAGGGTTTCCAATAATATTATGCAAATAATATTTAACTCTATCCCATACTTTTGTAGACATGGGAGTACAT GAAAATGTTTTTCTTAAAAGCATAATATCAGCTCCAAAGATAAGTTGATCATAATTTTTTGTATATAATTCAAATGTATC TCTCATTAGCATAATCTTATTACTTATATTATATGGGTTATGAAATTTGAACAAGGTTAGGGCATGTTTTTGATTAAAAT ACATTAAAAAAGCTTCATCTATAAATCTTTTTAAGTGAATGTTCCATTTACTATATTTCGGTGGTATAAAGGTACTCGTT TCATATTTTCAGGCTGTTATATCTTGTGTTTGCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200123: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001232320365AA5501131212m3gmbPfHB3.1, G. Roman Reddy


Date: 0:20:32 on Sat 25 Nov 117.