EST 1200125 is a singleton


Sequence

>1200125 (1 EST) Length=435 TATATATATATATATATGCCTGTGTAGGATGTTTGTAATATTTTGGGGTATGAAAGATCATCATTAAATATACACGCATC AGAAAAAGGTTTTCCAAACAGATATATAAATAAAATGTTTTATTAAATTGTCATTTAAGAAATTTGCATTGTGTGTATAG GTTGCATAGCTGGGTTGCTAATACTTAAAAAGGGATACGAAATATTAAATCTTAGCGAACATGGTATTAATAAAATTTTT GTTCTAAAATAAATTAACAAATAATATATATATATATATATTTATGTATGTATGTATGTATGTATTTCCCTTGTCTTTTA AGAAAATGGTATAATGATCAATGAATTTCTTTTAAATGTTGATAAAATCGAAAGCATGGCAAATTATATTATAGTTGTGG AAAAATATTCAGTTTACCAAAAACTTTGCGAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200125: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001252320367AA5501151214m3gmbPfHB3.1, G. Roman Reddy


Date: 2:20:6 on Wed 22 Nov 117.