EST 1200132 is a singleton


Sequence

>1200132 (1 EST) Length=277 TATATCTATTAATAAATTTGTAAAGTTAGAAAATATCATACGCATTTCTAATGTAACATAAGGTATCATTTCTGAATCAT CATTTTTTATATAATTATATAATATTAAATTTTCATTTAGTTTTTTTAATTTTTTATATAATTTATGATTTCCAATTTGC CCTTTTGTTTGTATTGAATTATTCCATATATCCATATTTATTAGATATTTATGTTTATCAAAAAAATGATGATTATAACT TAAGAAATATGAATAAATGAAATCATAAAATGACTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200132: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001322320374AA5501221223m3gmbPfHB3.1, G. Roman Reddy


Date: 21:21:34 on Sun 19 Nov 117.