EST 1200134 is a singleton


Sequence

>1200134 (1 EST) Length=661 CTACTATATTTTTTTTTTTCTCCTCTTCTTCATTTGGTCTTAAATATCCTACTCCATTAAATATCCATTCATTAAAATCA AAATTATTTTCTTTCAAAAAGCTAAGGGTACTTGTAGATACACTAAAATATTTATTTTCCTTAGGAAATACATAAATACA ATATGGTGATATATGCCACTCTTGTTTTTTTTTCTCTATATTACAAATTTTATTCATATTTCCATTTTCATATATAACCT TTCTTGTATGTACACTACTTTTTTTTTTTATTTTATTATTTTCCTCATCCGTCTGATATAAATCTTCAACTATATCTTTC TTCTTAGCAATAGATATTCCGATTTGACAAGGGAAAAATGATTTGGCTCCATAACAATGTGCTTCATAACTAGAATCTAG TGAAATATATCTTTCATCTTTTAAATGTAAACCTGTATATTCTACATCTATAGAAACAAAATCACTGTTATTAATCTTCT GTATTATTTCTTTGTGTATATTATTCCAATTATTTAAGTTAACACTTGTTATTTTAGAGTACCCCCTTTCTAATATATTA TATTTAAAAAACAAATTCCTCTTTTCTTTTAAAACGAAATTTTTAAAAAAATAATTAAAAACACTTGACATTATATCTAC ATGTTATTAAATAGATAGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200134: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001342320376AA5501241225m3gmbPfHB3.1, G. Roman Reddy


Date: 2:12:53 on Thu 23 Nov 117.