EST 1200148 is a singleton


Sequence

>1200148 (1 EST) Length=219 GTAGTAATAATNATAACAATTTAGAGAACATAAATTTGAGCCTACACAAAATATTTAATTGTCGTCATAGTGTTCCTAGT AAATTTATTGAAGATGAAAAAGAAAATATAAGGAAACGTAGATGCACAGTGGCTCATATGTATGAGAAGAATATNAATTC AAAGAATACTAATTATGATTATTTAACCTATAATTTTAATAACTCNATAAGAAAGAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200148: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001482320390AA5501381250m3gmbPfHB3.1, G. Roman Reddy


Date: 8:21:21 on Wed 22 Nov 117.