EST 1200149 is a singleton


Sequence

>1200149 (1 EST) Length=527 TATTCATGTGAGAATTAATTTTGGGGGACTCATAAAATGAGTAGCTTATGTATACATTTTAAAAACAAAATACATAGAAA TAATAATATACATATATAATACATTTTCTTATATTTACTTTTATTTTATTTTTAATTTGTAATAAACATTGAATGGAACC TATATCTTCATTGTTGTTTGTATTATATGGTTCGATGTCTATACAATAAATGTGTTTTCCTTTCTTATCATCATATTTAT AATTATCTTGAAAAGTTGTATTAATATAATTAACCATGTCATCATAATATTTACTATTAACAACGATAGTAATATATTTT AATCTCTGTTCAATAATATTTTTTATTATATAATATATCATACATCTATTACATATCTTTATTAATGCTTTACATTTATT ATCACATAATTCACTAGCAAAATGATTCTCATCAAGTGTCAAAATTACCACTTGAAATTCTACGAAGGTACCTGAAAGTA CCTTGGATATATTACAAGTTGACATTTACCAAAAAAAAAAAAAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200149: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001492320391AA5501391251m3gmbPfHB3.1, G. Roman Reddy


Date: 19:54:4 on Sat 18 Nov 117.