EST 1200154 is a singleton


Sequence

>1200154 (1 EST) Length=504 TTTATAAAAAAATAAAATCATACACATGTCATTTGCATAAGCCATAATATGTATTTTTTTTTTTCCCAAACACCCATATA TTATTAGGGTTGTAGCGTTTACAATAGTTATTGTAGTTGGTTTGGCATATGTTGCATTTATATTAATAGGTCGGTTTCAA TAATTGGATAAAAATAAAATAAAATGACAGAATGTTTAATTTATTAATGAAATGTATCATATATATGGACGTAAAATGAG TCTATGATATATTATATACATATATATATATTTAAATTTCAGTTTTCGCGGATGCTCAGAGGGACAATAAATAATATTGT AGAGAATTTTTTAAGGTAAAAAAAAAGTATATATATATTTAAGGAATTCTCCCTTTTTTTTTCTTTAAATATATATTATT TAATATGAAAATGAAAAAGGATATTATTTGCTTATTTATTTTATTTCATATTTTATTATTTATCATTATTATATATATGT TTTTTTTTCTCTCTTTGTCAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200154: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001542320396AA5501441257m3gmbPfHB3.1, G. Roman Reddy


Date: 13:5:10 on Sun 19 Nov 117.