EST 1200159 is a singleton


Sequence

>1200159 (1 EST) Length=563 ATTTTTAAAAAAAAAAAAAATTCACATTTGAATATTTCTTTAACACACAAAATTTATTACACTTTATTAGGATGGAGCAT TATATATAATACAATTCTTAAAAATAAATATAACCACAATGAACCTAACATCAAAATTATACTCATAAATTTTAACAACA AAAATATTCACTATATATATGATAATAAATGCGTACATCTTAATTCTTATTATGATTATCTATTTAAGAGGTTGAAATAT TTATTACATTTTTATAGAAACAAATTGATATATTTAAAGGAAAAAAAAAAAAAAAAAACAAAAAAAAAAAATAATAAAAT AAATCATACGGATAGGAAACATAACAATGGAAGTAATTATAGTACACATAGTACACATAATAATAATAATAATAATGATA TGGATAATTGTGGTAGTAGTAGGTATGTACCTTTAAATAATAATATTCATAATATGGATAATTGTGGTAGTAGTAGGTAT GTACCTTTAAATAATAATATTCATAATATACACACAGCAAAAGAGAATTACCAATTCAATCAATTTTCCATTTTTCCATT TGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200159: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001592320401AA5501491262m3gmbPfHB3.1, G. Roman Reddy


Date: 17:19:25 on Fri 24 Nov 117.