EST 1200174 is a singleton


Sequence

>1200174 (1 EST) Length=564 TATATATATAATAATTATAACACTTTATCACAAAAGAGAAAAGAAAAAAAACAACGATTCCAAATTGAAATAAAACAACA TATTTATTTTGCAAGAAAATTAATTTCAATAATTTCCTGTCCATTATTTTTTCGAATTCATATTAGTTCTTGTCACATAT TCTCTGATGTGTTTACATCTTCTGTTGTATATATAAAAGTTATTTTATTTTTAATATCTAATACATCAGTGTATCTTTTT GTACAATTAAATTAACATACAAACAAAAATAAAAATAAATATACCGAACTATTTTATTTTTTAAGAACTATGAACATATT ATGAAATATATATATATATATAATTATTAATCTTTTTTTTTTTCTTTCTTTCCTTTTTCTATTCGATTTTATATATCGTC ACTATTTCTTTCTACATTATATATATATTTATTTTGTAAAAAATAAATTATATGTTGAGCTAATTCGTATGATTTTTCTG TTAATACAAGATGGGAGCATTCAGGAAATATTATTAGCTTAACATTATTTAGATATTTTTTTTGTTTTTCTAAAAATTTT ATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200174: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001742320416AA5501641278m3gmbPfHB3.1, G. Roman Reddy


Date: 2:20:30 on Thu 23 Nov 117.