EST 1200178 is a singleton


Sequence

>1200178 (1 EST) Length=600 TATAATTAGCACAGTCTTAACGATGGATGTCTTGGTTCCTACAGCGATGAAGGCCGCAGCAAAATGCGATACGCAATGAA AATTGCAGTGACTGTGAATCATCAGAATGCTGAATGTAAACTACACCAATTCCCTTCGGGGAATAGTGGTACTCCTACAG AAAATAAAATAATACTTTGCTCTCTAGGTTTCTTTTAAATATAAAATATGTTTTCATGTTATATGTATAAAAGAAAAGAG AAATAGGAATTTATTCCAAACTAAAAATTAATTTTTAGTTAAAGTTTCTCGCTGAATAAAATTTATTTTCATTCATTTTC TAGAGTAACAAAAAAAGAATTCTTTTATTCTTTTTAACAAAGTGTTTGATTTGATGTTAGGAGGGCAAATCCGCCGAATT TAAGCATATAATTAANCNGAAGAAAAGAAAATAACTATGATTCCTTTAGTAACGGCGAGTGAACAAGGACCAGCTCAAAC GGTTAATCCTTCGTTTGGTGCAAACCTTTCGACGGAATTGTCGTTGAATTATTCCATGAATGCCTTTAATTTGAGCAAAG TGAGCAGGAATGCTTCCCCATAGAGGGTGAAAGGCCCATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200178: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001782320420AA5501681282m3gmbPfHB3.1, G. Roman Reddy


Date: 22:56:45 on Wed 22 Nov 117.