EST 1200187 is a singleton


Sequence

>1200187 (1 EST) Length=222 GTCGTAATTATATTTTATATTCATATTATGTAATATATTTGTGATTATTATAGACATGCTGTATATACATGTTAGTATAT CATAATGATCATCATAAACAATATTATCTATTTGTACATTTAAATTGCACATAAAATAATTTATAAAAAGTTTTAAAATT AAGCGTAATTGATTTAATGTAATATTGTTATACAATGTTATAGGCAATAACACTTTTTTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200187: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001872320429AA5501771292m3gmbPfHB3.1, G. Roman Reddy


Date: 11:15:13 on Sun 19 Nov 117.