EST 1200191 is a singleton


Sequence

>1200191 (1 EST) Length=448 TATAATTCTACAAGTACATTATATTTTTTTTAAAATTTAATTTCAATTTTTTTTTTTTTTTTTTTGAAAAAACGTCCTTT TATGTATCCCATTATTCCCAAAAAAAAAAAAAAAAAAAAAAAAAAACTTCNCCCGAAAATAAACCCCATGTGAAGATGTT ATATAGTATATTATATGAATTGAATAAAGAAAAATATATATTATTTGTCAACTTTATTATGCTTTTTTTTTTTGTAACCT CTTCTTTTGATATATTTTTTATTTGCTCAACATAAATATTAGATCCTATATCAACATAATTACTCATATTTGGATATATA TTTAAATCTATATTTTGATTCTTTTCTATATTATTATTTTTATTTACTTCCTTTCCCTCCTTTTCTTTTATCTGGAAACT ATTTATCATCTTATTCAACTCTTCATTCATTTTTATACAGCAATAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200191: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12001912320433AA5501811297m3gmbPfHB3.1, G. Roman Reddy


Date: 9:9:58 on Tue 21 Nov 117.