EST 1200203 is a singleton


Sequence

>1200203 (1 EST) Length=568 TTATTCTTATTTTTATTTTTTTTTAATATTTTTTGTTTTTTTTCCCGTATAGTTGTGGCTCTACCCTTTGTAGAAATTGT AAGAAGAAATAAGCAGAAAGAACATAAAATTTAAGTACAATAAACAATTGTCCAATTCAATTCAAATGTAAACATAGAAA AAAATTTTAAAATAAGTCTGACAAATCAAAAACAAAAATTGCAAAATTATATTTTTATGTGAAAAATCATATATAAATAA ATAATTAATAAATTTGAATGCTTATATTAATCAAACGTAAAGGAATATGTAATGAACATTATAAATAAAAACAGAAAAAT ATATAGAAAAGAACAATGCGAGAAAATTGTAAATAAAATGAAATAGTAAAAGTATAAAAAAAAAAATTTTAATAAGGTCT TAGAACAAAATTGAAGACAAAATTAACAATGAGTAAAACGAACTCTTACAAAACGAGTGAATGTCATATTAATGAAATAA ATACAGATTAATATATTGATAAAAACAATTTCATAGGTATGAACTTTTAATAAGTAGTTCCCATCAAAAAAATTAAATTA TTATAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200203: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002032320445AA5501931309m3gmbPfHB3.1, G. Roman Reddy


Date: 8:17:43 on Thu 23 Nov 117.