EST 1200205 is a singleton


Sequence

>1200205 (1 EST) Length=444 TTAATAATTAGGATATATTTCCTATTTTTACGTTTCATAAAATTTAGGAAGGTTCAATGTATAAGAACATAAAATGTAAA AGGAATCAGTGGTTCTTTCAGAAATGCCCCAATTAATGTACTTACAAAAGTCTTTGAATTTCTTTAATTTAGTAATATCT GTTCCTTTACCCTAATCAGACAAACAATAAATAAATAAATAAATAAATATATATATATGATAATTATATATCATCAATTT TTTTTCTTCTTTTGTTCCCCCCATTTATCTTATACTTCTATATGACAACACTTCCATAATAAGTATAATAAAAGATTTAT CTTGACGTTATTTGTAAATTCATTTTCCTTTATATTTAATTCACATATAGTAAGAAGACATTTTCCGAAGGATAATCTCA CTTCTTTGTCGCTTAGCATGAACTGTATTTCTTTCATAAATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200205: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002052320447AA5501951311m3gmbPfHB3.1, G. Roman Reddy


Date: 1:25:23 on Mon 20 Nov 117.