EST 1200211 is a singleton


Sequence

>1200211 (1 EST) Length=500 TACATTTAAGTAGGATACGTCCAGGTCCCTCAAGGTACCCCTAAAATAAATTTCTCCTAGATTTTCCCATATAGGAAATC TAATACTTTTTTGTTCGATAGATATAATATTTAACCCCTCATGTCCTTTAGGAGTATGAGATAAAGTAATGGTCACTCTT GGATTAGGTAAATTAATATTTTGGAGGTTTTTATATGACATATCTTCATTTTCCTCAATATTTTGCATTAATGTTAAATT ACGGACAAATAATTTTTCCAAATTTTTAATTGTTCTATCATTTTTATTTTTTCGCTCATCAGAATCGTCAGATAATGCTG TATTGAATGAAAAGTTTTTGTCTATATCATAATTTCTAACCTTTCTATAAATTTTTTTTTTATGAAATCTTTTAAAATTT TTACACATATGAGGAAAAATATTACAAGAAGTATCGTCTATATATCTTTTTTTTACATTATTTTTATTAGAAAGATAATT ATAACTTTTTGCTTGGATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200211: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002112320453AA5502011318m3gmbPfHB3.1, G. Roman Reddy


Date: 19:54:18 on Sat 18 Nov 117.