EST 1200219 is a singleton


Sequence

>1200219 (1 EST) Length=467 CTCGTTCACTAACTATACAACGGTAATACGAACAATTAAATTATACATATAAATGATTATTACATATACATATACATATA CATATATATATATTTTTTTTTTTTTGCTCTGTTAATTTATTTCCTTATATTTGTAAGCTAGGCCCTGAGTTGTTTAAGTA AAAGATTTACTTCAACATATAAAATAAATAAAACATTGACACCTAAAAATGACAAAAAAGATATTTATAAATACTACAAT GAAAGGTTAAGAGAAGATATAAAACCCTACAAATTAATACCAAGTCTTCCTACATTAAATCATTATGTGAACCCTTTGGA TATGACAAAATTTGCCATAAAATATATTTTAAGTTATCGTTTTTTTTTTATATATATGGCTAGAACGACATTTCAGGTTT ATATGAAAAGAAAATTATATTCACATTAAAATGTTCCACATATATCTATTATGTATTTATATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200219: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002192320461AA5502091327m3gmbPfHB3.1, G. Roman Reddy


Date: 9:24:7 on Sun 19 Nov 117.