EST 1200220 is a singleton


Sequence

>1200220 (1 EST) Length=282 ATTTATATATACATATATAGATTTTTTGAATTTACAAAGTAAATAAAAAAAATAATTTAAGATTATACTGATTTTTTCTT TTTCTTTTTTTGATTTTAAGAAATATTTAACTAAATCTTTTTTAACTTTTTAAGTCAAATAACACATGTGTTAAACAAGG AAATAAAAAATATTCATAACATATTACTTTGAAAAAAATTTTAAAGAAATAATTATTTCTATTACAAAAAAATATGGATC TTTCAATTTATATTATTATAACAGTTACACATTTGTAACAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200220: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002202320462AA5502101328m3gmbPfHB3.1, G. Roman Reddy


Date: 16:17:37 on Mon 20 Nov 117.