EST 1200223 is a singleton


Sequence

>1200223 (1 EST) Length=692 TATTTTTCCCCCATTTGTAGGGATTTTTTAATAAATGAGGGCAATATATAATTTCGTTTAATTCAATTTCTTTCATTTTG CTACTGTGCAGCAGCTTCAAATAGCAATAAAATGAACATTTTAAAGCATATCTTAGACTTTTATTTTGGTGTTTTAAAGT GCAATGAGGTTTATATTAAAATTAAAACATTGATATGATAAAATAACACTGGATCCCAATTGTAATAAAAATTGCATTTT CTCTTTTAAATACGAAGTAAAGTTACTCTGAAATTATGTTTAAGAAAGAACTAGCCACTTTTTTTCTTGCTATAGTTTTC CCTTTTTATATATTATTGCATTTCTTTTGTTTCTCCTTGGCATGCATTTATCAAATATAATCAGAGGAGGTTTTGTTTGT TTATTTGTGGTCTCAGAGTGTAGGGATTTCAAAGAATGTTTTAACAAATGAAAACAACTAGAGCAGACATATAAACAGTA TCATTTACATTCAAATTGTATTGAATTTTGTCACTGCTGGGGGATGGATAAAATGTGGAAGTGACAAAGATTCAAACATT CTGAACAATTGAGGTAGCTGTATTTTGCCCTGATTGTTTGAAACTAGAGATAATTTTTTTTTACCCCCAGGCTGTTTTTA TAAGGAATTCCCTTCAGTTACTCAAATACACCTCTTCCTTCACACTCAGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200223: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002232320465AA5502131331m3gmbPfHB3.1, G. Roman Reddy


Date: 10:55:38 on Tue 21 Nov 117.