EST 1200226 is a singleton


Sequence

>1200226 (1 EST) Length=484 TTACTATTATCATTAATATTATATAATGGTTGATCTTCTTCAATATATTTTATTATATTATCATTAAAAAGTTGGAATTG TTCATATGTATCTTTTAATTCTTTTAAATTTTCATCATCCGGATTTTCAAATTGCTCTTTAATTTTTTCATCTAAGGATA TATTGTTTATATTAACATCTATAGGATTATTCATATACATATCTTTATCAATACTTATATCATTATTTATATTATCATAA TTACTTCTTATTATATTTTTATTATTTCTTTCTATATTTAACTTCATAGTAAAACATCTTAATAATTCGTCATAATGATA ATTGAAATATAAATCATCATCTTTCATATTGATCTCCATTTTTTTTATTGCATCTTTCATATGAAATTTTATCTTTTTCT TTTCACAATATAAATTGTATCTTTCGATTTTTTTTCTTATCAAATCTCCTACACATTCTTCATAAATCCTTTCTAATATA TTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200226: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002262320468AA5502161334m3gmbPfHB3.1, G. Roman Reddy


Date: 2:51:52 on Sat 25 Nov 117.