EST 1200237 is a singleton


Sequence

>1200237 (1 EST) Length=643 AAAAATAATACCTATAAAAATATAAATATTAATAATAATGATGAAAAACCTGATACGTTCAAAGAAAAGCTATACATGTA CCAAATTTCCTTCCAACATTTACAAAATAAAACATAGTTATCCTTTTAATAATTTTACATATTGACGTTTTTTCGTCATT TTTTTTCTTCTTCTACTTCGTAAAATTAAATAAATAATAACCATAACCAAAATTATAACTACTATTGCAACAACAGAAGC AATAATAGTAGTAGTTAAAGTCATAGTTTTTGGTACGAAATTGGCAATCTCAGCAGTTTTAACACTTGCAACTTCCTCAA TGACCTGCTTAACTGTAGTTGGTATATGTGTTTTTATAGATGTATTAAGAAGGTTAGTCTTACTTGTATAAAGACAAAAA GCACCTCCTATCTCATTACTATTTTCCCCGCAAAGTGTAGTACCTAAACGTCTGATGACATCACCAAGAAGAATCTCATT AGCATAATTTTCTGCAGTTATAATTGTTTTCCATTGTGCTAGTGTTAAACAATATATATGGAATTTCGATATTATTAATT CAATGGCTTTAGATATACCAGCATCCGTCGCAGATTTAGCAACGGTAGTAGCAACATATTGTGTCCATGCAACATACCCT ACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200237: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002372320479AA5502271347m3gmbPfHB3.1, G. Roman Reddy


Date: 0:7:50 on Thu 23 Nov 117.