EST 1200238 is a singleton


Sequence

>1200238 (1 EST) Length=602 GTATTATTTTTATCTTCATTTGGTGAATAATGAAATACGTGTATTTTACAATTTGTATTATCATAATTATAAAGTGTGGT CATTTTTTCTTTCCATAATTTTTTAATATTTTCTTTATTATCGTAAATAGGTTTGGTTTCTTCGGTTAGGTTACGAATAT CATTTTGTTCCACATCACCAGAGTTTATATTATTATTTTTAGTATCATCATTGTTTACATTATCGTCATTATTTTTATTA TCATCATTGTTTACATTATCATCATTGTTTACATTATCATCATTATGCACATTTTCATTACTTATAACATTTTCACAACT TGTACCATTTTGATGAGAACTCCTTTTTTCATCATTCCCCTCAGTCGATTTATCATCAATAAACTCGTGCAGGTTTCTAA AAATATTTTTATAATAAAAACAGTCGGTTATAAAGACATTTTTCTCACATTTCAACATACAGCTCTTTTTATTTTCCAAA TAATTATCAAAAATATTTTCTTCAAAAAGAATTACATTTTTATTTCGTTTTCTTTTCTTTAACATTTTGGTAGATTTTTT TTCTTCCGATTTATTCCTGTGTTGCATATTTTCTTCAAATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200238: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002382320480AA5502281348m3gmbPfHB3.1, G. Roman Reddy


Date: 7:35:12 on Sat 18 Nov 117.