EST 1200249 is a singleton


Sequence

>1200249 (1 EST) Length=600 ATAAAATATATAAATTAATAAAACATGTTAATAATAAGAAAGGAAAATTTATTTATATACATTTCATAGAATGTGTGATT TTTTAGGAACAAAACTTACAAATTACAAATTACATGATATAAAAAAAGAGTTTAGTAAAAAAAGAAAACATTATGATGAA TATGATTTTTATGTGTATTACAAGAATTTATTAGCTTCCGAAAAAAGAAAAAAAGAAAGAAAGGAACAAAAAAAAAGGAA ACACTCAAATGAACAAGAGAAAGAAGATGAATTTAAACCTTGTCATTATATATCAAGTATATATAAAAGAGTAAAAAATA TCGAAAGAAAAAATATATATGATTATATTGATGAAGATGATAATATATATGAAGATATTGTTACTAATCGAAATTATGGA GAAGAACATAATTTTACAGATGACATAACCTTTACCTTTTTCAATGAAAATCTATCTTATACCTTATTAAGAAATAATAA CTACATTGATGGTCTTCCCATAGGTGTTAATATAAAAATAAAAAAGGATATACAAAAAAAACAATCTGACAATAATCAAA TTTATTCACATATTGAAAATAATGAAAACAAAGAAATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200249: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002492320491AA5502391361m3gmbPfHB3.1, G. Roman Reddy


Date: 17:17:25 on Wed 22 Nov 117.