EST 1200256 is a singleton


Sequence

>1200256 (1 EST) Length=659 ATTTTTAAAAAAGAATTTCTAGATAATTTTAAATATCAAAAAACTGATGAACGTCCGAATTCTTCAAATATAACATCGAA TATATCTAAAGGTAATAAATGGTATAATGAAGAAGCTATGAGATCTATTAATCAATCTATTGGAAGGGTTATTAGGCATA AAAATGATTATGGAGCAATTTTTTTCTTAGATTCACGTTTTTCTAATAATCAAAGAATTAAAGAAATATCTAAATGGGTT CGAACACATTTTAGAATCTATAGAGATGTTGAACAAATTCAAAGTGACATTGATAAATTCTTTGAATTGTTTAAAGGTCT AAATAATCCATTACAATTACAAAAAGATCAAAATATAAATCAGAAATCTAATAATACAAAGATAATGAATATTTATAATG ATAATATACATGACATGAATAATAGTAATACAATAAGTGAAGGAGGTGTTACTATAAAAGAAAATAATGAATCTATAGAT AATACAAATAATAATAGTTCCACGAAATTAATAGGAAAGAATTTTCAAGATTGCTTTATTAAAAGTGATAAAAATAAAAA AACAAATAAGCATGATATGCCACAAAATAAATTTTCTTTTAATCCAACAAAAAAAATGAAAAATCAACCTAAAATTTTAA GTATGATACAAAATATTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200256: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002562320498AA5502461368m3gmbPfHB3.1, G. Roman Reddy


Date: 0:15:45 on Thu 23 Nov 117.