EST 1200266 is a singleton


Sequence

>1200266 (1 EST) Length=542 ATAAGAATGGCAAAAAAAAAAAAACAAATTCATTTGAATATAATAGATTTTCAAAAATATTATCAAACTGATGATTTATT ATTAGATACCTCCATATCCACAGAAAAAAAAACAGTAGATAATCAAAAATTTATAAGAAAAAACAGAACGTTAGAAAAGG ATGAAGTGGTTCAAAATATAGACTGGAGAACATTTGATAATGAGAAAGAAAAAGAAACAAATAATGAGAATACTTCAAAT GTAAATAAAATAAAAAGTCCGGGACTTGAAAAAAAAAATTTTAAAAAAAGTAATGATGTTATAACTTTAGGAGCACGTAA TAAAAATAAATCAACCAATTTAAATGCTGATGATATAGATTTTACAAACTTGAGAAACAAAAAGAAAGAAGATGATATAG ATTTTACAAACTTGAGAAATAAAAAGAAAGAAGATGATTTAGACTTTTCAAATTTAAGGAATAAAAAGAAAGAAGAGGAA GATGTTGATTTCTCAAATTTAAGGAATAAAAAGAAAGAAGATGATGTGGACTTTTCAAATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200266: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002662320508AA5502561378m3gmbPfHB3.1, G. Roman Reddy


Date: 10:9:18 on Fri 24 Nov 117.