EST 1200276 is a singleton


Sequence

>1200276 (1 EST) Length=686 TTTAAATATTTAATTTTACCCGTATGAGGTTTAGAAAAAGGATAGAAAAGATAGGGTTGTAAAATGAGAGATAATAAAAA AGCTTTATAAAATATTGAATGGCATTATTATGAAATAATTTCTTTGTTAAAATAATTTTTGAATTATTGATATCAATTAA TGTGTGTGCATATAAATAAAATTTCCAAAAATTTTTTATTGTTACATTTTTGAAATCATGAAAATAATAATTTAATTCTT TTAAAATAATATTTTGTAGAAAAGGATAGAATTTGATTGTACTGATATATAATATTCTATTTAATATCATATGGTATAAA TATTCATATAAATACATATATTTTATATAAATATGTATCAATCTTTTTTTTTTTAAAATATTAAAAATGAAAAAGGAACT TTTCAAAATATAAGGAAAATATTTCTTAACAAGATTATTACAATTATAGAATTTTTCGTTCATTTCTTTTGGCATATACA AAATTGAATTTTCATCAAAAGAAGTATGTATATTTTTATCTTTATTCCAAAAAGAAATATTATTTTGTTTTTGCATATTT TTTTTCTTACAACAATTATTCAAATATATATATATGGAACATATATTATTATTTATTAAAAATTTATTATCACTAATTTC TTTGCTCATATTATATATAGTATTTATCAATTTTCTTCCTAATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200276: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002762320518AA5502661393m3gmbPfHB3.1, G. Roman Reddy


Date: 9:27:52 on Sun 19 Nov 117.