EST 1200288 is a singleton


Sequence

>1200288 (1 EST) Length=611 TTTTATTTCATTCTTATTATAATTTCCTATATATATACTATGCCATTTGTTAAATAATGGTCCTAAATATTTTGGACGGT AATTCATATGAATAATTTCTTCAATTTCTTCTTTTTTTCTTACATTTTCATTCACATCAAAATGGTTGTAATGAGAGTTA TGAGCCCTATGCCTTTGGCTGGAATGAGTATTATTTATAGTATTATCATATATATGTACATTGTGTAAATTATTATCTTG TGAGTTTATCATTTTGTCACATATATTGTCATTTATTTCATTATTATTATTATTATTATTATTATTTTTGTTGTTGTTTT TATGGTCCCTATTACACAATGTTATAGTAGCAAACAAACGAAAATCTTTATGTGGATATATGTATTCACCCTTTTCGGAT ATATATATATATCCTTTACTATTAACTTCTTCCAATTTTTCTATTATACTATTTGATATAGTATTAATATTTTCAAAAAC TATCCATTTCCCATCCATCATTGCTTTTGATAATATTCCATATTTATATTCAAAATAATTTTCATTACTTTCCCATACTC CTAAAATAGATTTAGAATCTGATACATCATCTAAATATACACTTATAATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200288: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002882320530AA5502781407m3gmbPfHB3.1, G. Roman Reddy


Date: 23:44:23 on Fri 17 Nov 117.