EST 1200293 is a singleton


Sequence

>1200293 (1 EST) Length=641 CATCAGATTATAAACAAGAATCTTTCAAAAAAAGGTATTCCCGTTATTTATAAAAATGGAGAACAATAAAATATTCAACA ATGATAGATCAAAATACCTCTATAACAGAATGTCATATAGGCAAAACTGTGACTGTAAAGAATTTTTTTTTTTTTTAGAC GCAGTCTCGCTTGGAGTGCAATGGCACGATCCTGGCTCACTGCAACCTCCGCCTCCCAGGTTCAAGTGATTCTCCTGCCT CAGCCTTTTGAGTAGCTAGGATTACAGGTGCCTGACACCACGCTTGGCTAATTTTTTTTTTTTTTTTTGTATTTTTAGTA GAGATGGGGTTTCACCATGTTGGTCAGGCTGGTCTTGAACTCCTGACCTCGTGATCCGCCCACCTCAGCCTCCCAAAGTG CTGGGATTACAGGCGTAAGCTACCGTGCCTGGCCAAGAATTCTTTAATGATAGAATAAAATGCTTATAACACTCAATGAA AAAAGCAAATTTTTGTTTTTTTAGATAGAGTCTCGCTGGAATGCAGTGGCACGGTCTCGGTTCACTGCAACCTCCGCCTC CTGGGTTCAAGCGATTCTCCTGCCTCAAGCTCCCGAGTAGCTGGGATTACAGGCACCTGCCACCATGTTGGGCTAATTTT T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200293: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12002932320535AA5502831412m3gmbPfHB3.1, G. Roman Reddy


Date: 20:47:42 on Wed 22 Nov 117.