EST 1200303 is a singleton


Sequence

>1200303 (1 EST) Length=571 TTATTATTTCATTATTTTATTATTTTATTTTATTATTATTTTATTTTATTATTATTTTATTTTATTATTTTATTTTTACA AGTCGGGGTCGTTCCAGGGGGAAGATGGGGTTAACTCATAATTTATTACCTTTTCAAGTAAACCTGAATTCCATATTCCC TGTAGTATATGTCCATTAACAAAGGTTAAAGTACCTTTTCCATGTTTTCTATTAAATTGGAAATGTCCAGAATAAATAGT ACCATCTTCTTTACATGTAAATGTACCCATACCATGTCTATGATCATCTAACCATTCTCCTTCATATTTATTTCCATTAT TATATAATAGAATACCATATCCATTAGCTTTATCATTTTTCCATTGTCCTTTAAATTTATCACCTGAAGCATATATTAAT TCTCCTTCACCACATTTTTTAGCATATTTCCATTCACCTATATATTTATCTCCTTTACTATATGTGAGAGTACCCTTTCC ATGAACTTTATCATTTTTCCAATAACCTTCATATAATTCTCCATTAACATAGGTAAGTGTTCCATAACCATTTTTCATAT CATTAATCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200303: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003032320545AA5502931422m3gmbPfHB3.1, G. Roman Reddy


Date: 3:43:30 on Sat 18 Nov 117.