EST 1200304 is a singleton


Sequence

>1200304 (1 EST) Length=504 TTTATACCTTTTTCAATATATTTTAATATATTTTTAAATAAACAAATTTGTATATTTTCTTCCTCTTTTGGATTATGTCA TCTTATTTCTTTATTAAAAATATTTACTCACCAAAATTTAATATCTAATCCTATTTTATATTTGTTAAGAATAAAAATTA GTAAATATAATAAATCATTAACATATAATGATATAAAAAGTAAACATATAAATGAAAAACCGGATGAAATCTTCCCTTCA ATAAATTACACAGGCAATATAAAAATAAGTTATAAAGATATATATTCAATATTTTATCATATGCATTTAATGAGAGTACA GTATATGGACTTGGCTATAAAATGTATAGAATGTATATTTTTTATGGAAAAAAATTTTAAAAATATATTTTCTGAGGATA TAGAATATATAACAAATTCATGTTGTTATTTCTTATTACTTAATGATAATTATGATGATCCATTTTTAAGAAAATTTATA AATGTTCATATAGAAAATTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200304: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003042320546AA5502941423m3gmbPfHB3.1, G. Roman Reddy


Date: 9:33:54 on Thu 23 Nov 117.