EST 1200309 is a singleton


Sequence

>1200309 (1 EST) Length=599 AAAAATATATTTATATGTACAATACTTACTTAACTCTTTATTCACATCCCAATTTTCGTCACTCTTATTTTTTACTTCAT TCAATTTATGTTTTACTACTTTCATCTTTTCAAGATAAAATCTGATGGTTCATAAAAAAAAAAAAAAAAAAAAAAAAGAA CCAGTTTGATCACATTATAATACACACATTTGATTATATTATAATATTAAATATTTGTTTTTATTTATTCTTTTTATTTT CATATTTAATACTTTTCATATGCACTCAAAGTTTTATTAATTTCCTTTTTCTTATCTATACAATATGACAAGACATAATA AATAAATAAATAAATATATATATATATATATATGTATATGTGTAGGTCCATTTGAGCATATCATATTATACCTTTATATT TCATAATAGTCTGATTATTTTTTATTGGATTTTTTTTCCTGAGGAATCAAAAAAATATATAATATATAAATTTCTTTTTT TTTATAGACCATGTTTATATATATGTTAGAATATCACAAGGTACATAAAAGAATGATATAATATCGTTTAATATTTATAT TTATAACATGTTGGTTATTGTGGAATTTCGTTTTCCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1200309: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003092320551AA5502991428m3gmbPfHB3.1, G. Roman Reddy


Date: 6:49:26 on Sat 25 Nov 117.