EST 1200313 is a singleton


Sequence

>1200313 (1 EST) Length=597 TTTATTTAATTTTTTTTTTTTTTTTTTTTTTGTTATTTGACTGATGTAATGTCAGAAAATTTGCCCTAATATATAACTCA TTTTGTTTTGCATATTTATTTTAATTTTTTCTGTATATACACATCATTGATAAATGAAGATTTTCCTTTTATGTTTTGCT TTGTTATTTGTACCATATAAATGTTTAATTATAACTTTGAAAAATGATAACACATTTTTTGTCTTTCCAAATATAATGAA AAACAATAGGAACTTATCGAAACGTAATTTTACTACCTATATGAAGCGCTTAAGGAATGCTAGTGTGGAAATTGATTTGG TTAATCGAAAAGATTTAACAAAAGTGGAAGTTATTAAAATGTTTTTAAAAGGTGTTAAAGAATGTAAAAATGTAGAATAC TTGAAAGAAAAACATAAAGGACATGTTCCACCAACCACCAAAAGGAAATTAATGAAACAAAAAAGAATGATTAATTTAAG AGCACAAATTAAAAATACAAGATTGAAAAAACAAGAACAAGTACCTGAAGATAAAAATATTCTCAATTTTCCAGAAGACC AATTAAAAAATATAAACGCAGCTGTTTTATATTTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200313: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003132320555AA5503031432m3gmbPfHB3.1, G. Roman Reddy


Date: 12:42:51 on Tue 21 Nov 117.