EST 1200320 is a singleton


Sequence

>1200320 (1 EST) Length=539 TTTATTTATTTATTTAGTTGGCAGCTCGTTAATACATGAATTATCTCTCGATGGCCCTTATACTGCATTTCTTCCCTCCA ACGAAGCCATGCAATTAATAAATATAGAAAGTTTCAATAAATTGTATAACGATGAAAATAAATTATCAGAATTTGTTTTA AATCACGTTACGAAAGAATATTGGCTGTATAGAGATTTATATGGTTCATCTTACCAACCGGTTAATAAAAATAATAAAAG GAAAATGTGCATAAATATATACATATATATATATATTTCATTATATATTATTTTTTTTTTACACCTTACAGTGGTTAATG TACAATGAAAAAAGGGAAGCTCCAGAAAAATTAAGAAATTTATTGAATAATGATTTAATAGTAAAAATTGAGGGGGAATT TAAACATTGCAATCATTCGATATATTTAAATGGCTCAAAAATTATAAGACCAAATATGAAGTGCCACAATGGAGTTGTGC ATATAGTAGATAAGCCCATCATTTTTTAAAAAACAACACAGATAAATTAACACACACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200320: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003202320562AA5503101441m3gmbPfHB3.1, G. Roman Reddy


Date: 12:53:17 on Sat 18 Nov 117.