EST 1200322 is a singleton


Sequence

>1200322 (1 EST) Length=494 TTATAATTATAAAAAAAATATACAATCATAAACAACTAATTATAACATACATATATATGCACATTTTTATAGGTAAGTTC CCCTCAAAAAAATCCATCAATCACACAAAAAATACCAACAACGAGGTTATTATGCGAGTGCGACCTATATACGCCTAATT ATGATAATCATCCACAAATGAAAGAAGTAATGCAACAATTTGAGGATCGTACGTCACAAAGATCTCACGAATATGACGAC CGTATGGTCGAAAAACGAAAGCAATGTAAAGATAAATGTGACAGAGAAATCCAAAAAATTATTTTAAAAGATAAAATAGA AAAGGAATTGGCTGAAAAGTTCGTTACATTAGAAACAAACATAGACACCAATGATATTTCCACATGTGTTTGCGAAAAGT CGTTAGCAGATAAAACAGAAAAATTTTGTCTGAACTGTGGGGTGCAACTAGGAGGTGGTGTGTTGCAAGCTTCGGGTTTA TTAGGAGGAATTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200322: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003222320564AA5503121445m3gmbPfHB3.1, G. Roman Reddy


Date: 19:22:45 on Sun 19 Nov 117.