EST 1200326 is a singleton


Sequence

>1200326 (1 EST) Length=754 TTTATTTATTTATATTCAAATAAATATAATATATTTAAGCATATATAAGATGAATAACGAAATCGTAAATTCCACAATCG ATGGGGTCCTGAATACAAAATTGCATATACAAAACATTCCTCCACATATTACGGATGTACATTTAAGGTCATTATTGGGT AATGTTGGATTTATTAAAGACATATGTTATTTTAATAAAAGCAAAAAACAAATGAACAATAATAACTTTGCTAATAAGAA GATTTATAACACTGCTTTGGTTACATTTAATACACATGAAGAGGCCTTAAATGTTTTGAAAAATATTAAGAACTTAATCG ATACAAGTGGAGAAGAAAGAAATATTGATGCTAAGTTTGCTGTTCCAAATGTAAGTATTAACAATAACAATAATAATAAT AATAGTAATACCTTTTTTCAGAAAAATAATATGAACAATACCAACTTTTCACAAGGATCTACGAACTATGGAAGTAATTA CAATAGCGAGAATTTCCAAGGAAATAATAATATGAACAATTATAATTTTTATAATAATAATAGTAGTAATAATAATAATA ATAACCAAACAAATACTCAAAACAATTTTATGAACAGAAATATGAAAAATAAAAATATGAATAACAACAACAACCATAAT AATAGTAATAATAATATGATGATGAATATGAACTTTAATAATAATCAACAGATGAATAATAATCCTATGCTGAATCAGAA CAATTTTATGCTTAACAATAATAATAATTATAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200326: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003262320568AA5503161457m3gmbPfHB3.1, G. Roman Reddy


Date: 2:16:36 on Thu 23 Nov 117.