EST 1200327 is a singleton


Sequence

>1200327 (1 EST) Length=704 TATATTTTATGGGGGCCATATTTATAAGATCCATTATGAACATATTAGAAAATATTACTTCCAATGAAAAATTCAAAATT TATACATACAAAACGTTTTTTACATATGAATTAACCATGGATGAAAAAAAGCAACCTACTGTTATACGCAAATTTAAAAA TCCTTTTGATCAAGGAATGCTTTTTAACTTCATAAATTTTTTAACTAAATCAAAAACAAAGTTAATTAAAAAGGAAAAAC AGTTTATAATAATTGACAAAAATATTAAAAGTCAAAAGCTTACAGAATTTGTTGACAAATTGAATAAGCGATTAAACGAA ATGAACATTGAATGAAAACTATTAATGCAAAAAATAAAATATAATAATAATAAATGAAGAATAAAAAAAATTATGAAATG TGGTAATTTATTAAGTGTAATTATAAGAATAAAAATAAAATGGACACACATATATACATATTTGTATATATATATATTTA TTTATTTATTTATATTTTTTATCTTTTGAATTTTATAAATTTTTGCCTGACTTGTTCATAATTTTTTTTTTTTTTTTTTG CAAATTAAACTTCAATACTGTGAAAACATAACTAACGTGAAAATTTTGTGTAACAATACTTATGATATTATGATTATAAT TTTGTTTTAATAATTTATGAATATATGTTAAATTATTATCAATATTTTGTATAACTTTATCTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1200327: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003272320569AA5503171458m3gmbPfHB3.1, G. Roman Reddy


Date: 2:19:43 on Thu 23 Nov 117.