EST 1200330 is a singleton


Sequence

>1200330 (1 EST) Length=385 ATTTTTTTTATTTGAAAAGTATTACGCGAGGATGTCTCTGAACATTCAAGAACAACAGAAGAATAGTGCGATAAGTATGC TAAATTTGAACGAGTACCAAGAAAATGGAAATAACAGAGGGAATATATTGTACTATTCACATGACAAGATATGGAAAATT TTAATATATGATAAAGAAGGACAGAATATTTTAGCTCCATTATTAAAAGTAGGGAATTTAAGACATCATGGTGTAACATT AAATATGAATATACAGAGAGAAAGAAATTCGATTCCAGAAGTAAATGCTGTTTATTTGATTGATAATAATAAAGAAAATA TAGATAAGGTTATTGAAGACATGGTAAAAAATATGTATGGTAGTTATTATATAAATTTTTTATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200330: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003302320572AA5503201461m3gmbPfHB3.1, G. Roman Reddy


Date: 21:20:22 on Sun 19 Nov 117.