EST 1200331 is a singleton


Sequence

>1200331 (1 EST) Length=215 AAAAATAAAAAAAATTGCGCCACCCCCCTCCGGGTAACTCAGCAGCTCGATTTGCAACTTTTCTTATGAAATTGTCGGCA AGCGGAGTCGAACCAACGTTCTCACAAGGAAAGCTACATACCTAACGACTGGGCTACTGAGGCAGCTTAATAATATTACT AACATAAAAGTATTATTAAAAATGGTAAGTACGCACATAATATATATATATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200331: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003312320573AA5503211462m3gmbPfHB3.1, G. Roman Reddy


Date: 7:25:55 on Sun 19 Nov 117.