EST 1200340 is a singleton


Sequence

>1200340 (1 EST) Length=647 AAATATATTATACACATATGTGTATTTATATATTTATTCCATGTGTTTACATTTTGATTACTTTTCGATTATAATATTTT CGCTTTTCATTTTTTGGTAGACTTCTTCAGGTAATTGTTGTAATATATCATCACTATATTTATCTAACAATTTGAGTTTT TCTTGTTTTATGAGTTGTTCATATTTTTTTTGTTCTTCCATTAATTTTTCTTTTTGTACTTGTTCTTGTAACCTTTCTTG TTTAATTGTTTCTTTTTTTTCTTGGAATGTTTGATAAATTTCTTTTCTATATTGTAACAATTTTTCTTTTTTCTTTTGAT CTGTATATTGATCTAATTTGTCTAGTTTTTTTTTTTCTTCTAACAATTGTATTTTTCTTTTTTCATCTTCTTGTTTTTCT GCTAACCTTTGTTGTTCTTTTAGTTGTATATCTTGTTCTAATTGTTTAAGCATGTCATTTTTAAGTTGTAATTTTTTTTG ATTTTCTTTTAATTCTTTTTGTTTTTCCTTAAAATCATGTTCTTCTATATAAAGTTTATTTAATAATTCATCTAATGTTT CTTTTTCTTTATTAACTAGATATTCCTTATATGCTATTTGATTAACAACTTTTTGTTTTTGTATATTTTTATCTTGTTTA TTTTGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200340: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003402320582AA5503301471m3gmbPfHB3.1, G. Roman Reddy


Date: 12:6:19 on Fri 24 Nov 117.