EST 1200344 is a singleton


Sequence

>1200344 (1 EST) Length=170 TTTCTTATATATATTAAATAATAGTAATTAATTTAAATATCATGAAATGTTTATAAAAACGCGTGACCACCTTTTTGTCA GTTTCCTATTTCTTTTCTACAATTTGGTACAAGAAAAAAAAAAAAAAAAGTATCCATAGACATTTTTTAATATAAAAGGA TCAAATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200344: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003442320586AA5503341475m3gmbPfHB3.1, G. Roman Reddy


Date: 3:49:59 on Sat 18 Nov 117.