EST 1200345 is a singleton


Sequence

>1200345 (1 EST) Length=696 TGAATGTTCATATGGAAAATAAAAGAGTATATTTTCATAAAAAGAATAAAAAAATAAAGAATGAATATCTTTTTCATTGA TATTTAATTTCTTTGTTTTTTTTTTCATAATATCTAAACTATTTAATAATGATTGTGCATTTGAAGGAGTTTCATATTTT TTTATGAAATGAATATTTTTTTCCAAATTTTTATAAACCAATTCTGTATATTCATCTTTTAGGTCATCATTTTCATCCAT AACATTTTCATTAATAACATCTAGTGATAAAGAATTATTTTTAATAAAATAATTTTCATTAAATATCTTTTTAGAGACTT CCGCTTTCATATCATTACAAGAGATGTTTATTTTATTGTTATCTCTTGTTTGTTTCTTTTCTTCTATTTCTTGATAATTT GATATATCTAGATATATTTTTTTTAATTTATTATTTTTATAGTAAAAATTGTAATCTGTAAAACCATGAGAAGGAGCCAC ATGTACAATACCTGTTCCAAAGGATTCTTTAATTTCGTTATCAGAAACAAAAATAAAATTATTTTCTTCATTATTTGTAA AATTTTTATATGTACAAGACATAAAAGAATTACCTTGGAAAGTACAAATATTTTTTATTTCTTTTATTGGTGATTTCTTG GAATAATATTTTGTTAAATTATCAGAAAAACTATTATATGATTTGTCACATATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200345: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003452320587AA5503351476m3gmbPfHB3.1, G. Roman Reddy


Date: 16:25:53 on Sun 19 Nov 117.