EST 1200348 is a singleton


Sequence

>1200348 (1 EST) Length=142 ATATATATATATCACATTTTGTGATCATATTAACCAATTAATTTTTGTATACATTCAACCTTTTCACCAACCTCTTCTAT TCCCAACATATTCACATAATTTATCATCTCCACAACCCCCATTATTATGTTTACATAAATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200348: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003482320590AA5503381479m3gmbPfHB3.1, G. Roman Reddy


Date: 11:53:33 on Thu 23 Nov 117.