EST 1200352 is a singleton


Sequence

>1200352 (1 EST) Length=275 CTAATATTAAAAGAGTTCATNTCAAATATAGTTCAATATAAATTTTGTTTTTCCATTTNTTTCTTTTTATGAAATGTCTA CAACAAATATATTAAAACCAAAAATTATAATTGAATCGTCCAAAGAACAAGGAGTAGGGGAGAAAAGGTCTTCAACATTA TCTGCGCCATTTGAAAAAAATATGTTTAGCACTTATTCATATAGTAACCCTATATCTAACATGAGGAGTANCACCCATAA NGAATACAAGTATAATTGGACAAAATATGTGAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200352: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003522320594AA5503421483m3gmbPfHB3.1, G. Roman Reddy


Date: 9:2:2 on Sat 18 Nov 117.