EST 1200353 is a singleton


Sequence

>1200353 (1 EST) Length=524 CTTCAAAGAAAGATTTTGCTACCAGAATGATGGAAAAAATGGGATGGAAAAAAGGAGAAGGTCTAGGTAAAGACAAACAA GGTATTAAAGCCCCACTCATTTTAAAAAAAGTAGATAAAAGAAGTGGGGTTATAGTACAAGCACCAGTTATTTTAAAAAA TAATGATTTAAATAATAAAGGTGAAAATTTATCAGTACCAAATGATTGTACCAGAATAGTTCACCTAACTAATTTAGTTA CCCCAGAAGAAGTAGATGAAACATTGAAAGAAGAAATTGAAGAAGAAGCATCCAAATTTGGAAATTTATTAAATATAAAC ATTGTAGTTGATAAAAATTTACTTGATGCCCTTGCTGTCAAAATTTATTGTGAATATGAATCAAAAGATCAGGCGCAAAA TGCTCTCAATACATTCAAAGGTAGAACATTTGCAGGAAGAAAAGTCCAAGCGTCTTTTGCTACTGAGGAAGAGTACGAAA CTCTTGAAAATAATGATTGAAAAAAAATATAATATGTATACAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200353: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003532320595AA5503431484m3gmbPfHB3.1, G. Roman Reddy


Date: 14:7:1 on Fri 17 Nov 117.