EST 1200356 is a singleton


Sequence

>1200356 (1 EST) Length=510 AAAACAAAAAAAATATGATATACATTGCCAAACCTACTCCAGTATATAATGAAATATGGGAACAAAATGAAGCAGTCGAT GTGTGCTGTGATTTGGATGAAATTATGGTACCCTCACAAAGACAAAAGCAAAATATTATACAAATATATAAGTAAATAAA TATATATATATATGTTATTTTATTTCATATTTATTTTTTTTATATTTAATTCCCTTTTAGGTGCTCATGTCCAACTTGTA CTTATACGGATTTTCTTCAGTGGAAATTTTAGGAGGTGATAAGAAAAAAGTAATAGCTAACGAACCCAAAGTATTTTTCA ACCATTTCAATAGAAAACCAAAAGTTGAAAAAAAAGAAAACGATATTNAATTTGAAGAACCAGAAATTCATGAAAATATT AAAGTCTTAAACCCTGTACTATACATGTTCAAATATTTTAAACCATCATATTTTAATGTTAAGAAAATTCAATGTAGTTA TAATAAAAATAGTCTCTCAATTATGAATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200356: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003562320598AA5503461488m3gmbPfHB3.1, G. Roman Reddy


Date: 14:39:53 on Fri 17 Nov 117.